Free access

The Journal of Clinical Psychiatry

Original Research June 30, 2009

Association of Adverse Childhood Environment and 5-HTTLPR Genotype With Late-Life Depression

; ; ; ; ; ;

J Clin Psychiatry 2009;70(9):1281-1288

Article Abstract

Objective: Neurobiological and clinical studies suggest that childhood maltreatment may result in functional and structural nervous system changes that predispose the individual to depression. This vulnerability appears to be modulated by a polymorphism in the serotonin gene-linked promoter region (5-HTTLPR). Little is known, however, about the persistence of this vulnerability across the life span, although clinical studies of adult populations suggest that gene-environment interaction may diminish with aging.

Method: Depressive symptomatology and adverse and protective childhood events were examined in a population of 942 persons aged 65 years and older, taking into account sociodemographic characteristics and proximal competing causes of depression (widowhood, recent life events, vascular and neurologic disorder, and disability). Subjects were recruited between March 1999 and February 2001 and were diagnosed as depressed if they met 1 of 3 criteria: a diagnosis of major depression on the Mini-International Neuropsychiatric Interview, a score higher than 16 on the Center for Epidemiologic Studies-Depression Scale, or current treatment with an antidepressant.

Results: Exposure to traumatic events in childhood doubled the risk of late-life depression and increased the risk of repeated episodes. Not all events were found to be pathogenic; significant risk was associated with excessive sharing of parental problems, poverty or financial difficulties, mental disorder in parents, excessive physical punishment, verbal abuse from parents, humiliation, and mistreatment by an adult outside the family. Interactions were observed between the 5-HTTLPR long (L) allele, poverty, and excessive sharing of parental problems.

Conclusions: Certain types of childhood trauma continue to constitute risk factors for depression in old age, outweighing more proximal causes. Gene environment vulnerability interaction is linked in older age to the L-carrying genotype, modulating the effects of general environmental conditions rather than aggressive acts on the individual, perhaps due to increased cardiac reactivity.

Submitted: July 1, 2008; accepted September 15, 2008.

Online ahead of print: June 30, 2009.

Corresponding author: Karen Ritchie, PhD, Inserm U888 Pathologies of the Nervous System, La Colombiרre Hospital, 39 Avenue Flahault, BP 34493, 34093 Montpellier Cedex 5, France ([email protected]).

Association of Adverse Childhood Environment and 5-HTTLPR Genotype With Late-Life Depression

Objective: Neurobiological and clinical studies suggest that childhood maltreatment may result in functional and structural nervous system changes that predispose the individual to depression. This vulnerability appears to be modulated by a polymorphism in the serotonin gene-linked promoter region (5-HTTLPR). Little is known, however, about the persistence of this vulnerability across the life span, although clinical studies of adult populations suggest that gene-environment interaction may diminish with aging.

Method: Depressive symptomatology and adverse and protective childhood events were examined in a population of 942 persons aged 65 years and older, taking into account sociodemographic characteristics and proximal competing causes of depression (widowhood, recent life events, vascular and neurologic disorder, and disability). Subjects were recruited between March 1999 and February 2001 and were diagnosed as depressed if they met 1 of 3 criteria: a diagnosis of major depression on the Mini-International Neuropsychiatric Interview, a score higher than 16 on the Center for Epidemiologic Studies-Depression Scale, or current treatment with an antidepressant.

Results: Exposure to traumatic events in childhood doubled the risk of late-life depression and increased the risk of repeated episodes. Not all events were found to be pathogenic; significant risk was associated with excessive sharing of parental problems, poverty or financial difficulties, mental disorder in parents, excessive physical punishment, verbal abuse from parents, humiliation, and mistreatment by an adult outside the family. Interactions were observed between the 5-HTTLPR long (L) allele, poverty, and excessive sharing of parental problems.

Conclusions: Certain types of childhood trauma continue to constitute risk factors for depression in old age, outweighing more proximal causes. Gene environment vulnerability interaction is linked in older age to the L-carrying genotype, modulating the effects of general environmental conditions rather than aggressive acts on the individual, perhaps due to increased cardiac reactivity.

J Clin Psychiatry 2009;70(9):1281-1288

Submitted: July 1, 2008; accepted September 15, 2008.

Online ahead of print: June 30, 2009 (doi:10.4088/JCP.08m04510).

Corresponding author: Karen Ritchie, PhD, Inserm U888 Pathologies of the Nervous System, La Colombiרre Hospital, 39 Avenue Flahault, BP 34493, 34093 Montpellier Cedex 5, France ([email protected]).

Neurobiological studies have demonstrated that childhood maltreatment may alter brain development by programming the glucocorticoid, noradrenergic, and vasopressin stress response systems to overreact to new stressors,1-3 thus rendering the individual increasingly vulnerable to psychiatric disorder. These effects appear to be long-lasting,4 inducing structural and functional changes, notably reduced development of the hippocampus and amygdala, and abnormal frontotemporal electrical activity.2 As these brain structures have also been implicated in the etiology of depression, it is not surprising that child abuse has been associated with increased risk for depression during childhood and also in early adulthood.5,6

Not all children exposed to traumatic experiences subsequently develop psychopathology, and accumulating evidence suggests that vulnerability for depression is influenced by variation in the serotonin transporter gene (5-HTT).7,8 A functional insertion/deletion polymorphism in the serotonin gene-linked promoter region (5-HTTLPR) has been shown to modify the association between stressful life events and depression onset.7 The 5-HTTLPR short (S) allele appears to reduce in vitro transcriptional activity of 5-HTTLPR, resulting in decreased expression of 5-HTT. Most replication studies have confirmed this original finding, although a few have not, particularly when older subjects have been included.9 It has also been observed that a supportive early environment appears to reduce symptomatology in S/S homozygous subjects exposed to childhood trauma.8,10

Clinical studies of child abuse have focused on the implication of these events in childhood and adolescence on the assumption of a proximal effect of life events on psychological health. Little is known about the persistence of this vulnerability across the life span and whether adverse childhood events continue to constitute a significant risk factor for depression in old age. The role of the 5-HTTLPR genotype in mediating the late-life impact of child abuse is also uncertain. In a small community sample of 194 elderly subjects, depressive symptoms were observed to be associated with abuse and neglect in childhood11; however, the sample size was too small for adjustment for other possible causes of depression. A study by Surtees et al12 combining childhood and adult life events in a sample with an age range of 41 to 80 years found a strong relationship between childhood events and recent episodes of major depression. No interaction effect was found with 5-HTTLPR genotype; however, a trend was observed in the opposite direction, with the long (L) allele constituting the interactive risk factor in men. Taylor et al13 noted that, in elderly persons with depression, smaller hippocampal volume was associated with earlier depression onset and the S/S genotype, as opposed to late-onset (over 50 years) depression, in which reduced hippocampal volume was associated with the L/L genotype. Traumatic events were not examined.

Studies to date thus suggest that gene-environment interaction in the genesis of depression may not be the same in elderly populations as in childhood and young adults. Furthermore, while candidate environmental pathogens are generally considered to have greater impact when they are proximal to depression onset,14 biologic evidence suggests that childhood trauma, occurring at critical stages of brain development, may lead to more permanent structural and functional changes. The present study aims to examine the relationship between childhood trauma and late-life depression in an elderly general population cohort, taking into account other more proximal risk factors for late-life depression, and 5-HTTLPR genotype interaction. Adverse childhood events are examined individually along with potential environmental protective factors.

METHOD

Sample

Community-dwelling persons, 65 years and older, were recruited by random selection from the 15 electoral roles of the Montpellier District, France, between March 1999 and February 2001 as part of the Esprit study of late-life psychiatric disorder.15 Refusers (of whom 3.3% were excluded due to severe disability) were replaced by another subject drawn at random from the same electoral division such that each division was equally represented. Subjects refusing were slightly older and more likely to live alone than nonrefusers. Subjects were subjected to a baseline examination and reexamined on 2 further occasions at 2-year intervals.

Measures

Participants were asked to attend a half-day examination by a neurologist and a center interviewer (nurse or psychologist) at the Gui de Chauliac Neurology Hospital (Montpellier, France). Disabled subjects unable to come to the study center were interviewed in their homes. The following procedures were carried out:

Standardized health interview. The health interview covered the participant’s present state of health, individual and family medical history, and medication use—subjects were asked to bring their medication to the center and the type of medication was noted according to the World Health Organization’s Anatomic Therapeutic Chemical Classification.16 Disability was assessed by the Lawton Scale for Instrumental Activities of Daily Living (IADL).17 Exposure to adverse life events in the past year was assessed using the Gospel Oak questionnaire,18 a 12-item list of major adverse events covering bereavement, rupture in significant relationships, financial and legal problems, dismissal, severe illness, and loss of a highly valued object.

Standardized neurological examination. The neurological examination was based on International Classification of Diseases, Tenth Revision criteria19 and was designed to detect neurologic and cardiovascular comorbidity, including measures of sitting and standing blood pressure. It was carried out at baseline and at each follow-up examination.

Standardized psychiatric interview. The Mini-International Neuropsychiatric Interview (MINI) (French version 5.00)20 was used to record lifetime and current DSM-IV Axis I psychiatric disorder.21 The MINI has been validated within the French general population setting.21 Positive cases were reviewed by a panel of psychiatrists. The Center for Epidemiologic Studies-Depression Scale (CES-D)22 was used to detect high levels of depressive symptomatology. Case-level late-life depression was defined as a MINI diagnosis of current major depression, a score above the 16-point cutoff on the CES-D, or current treatment with an antidepressant at baseline or at each follow-up examination.

Childhood environment self-report. A retrospective self-report questionnaire examining traumatic experiences during childhood and adolescence based on a review of existing instruments and covering 25 adverse and 8 protective factors was given to subjects for completion in the third wave of the study (4 years after recruitment), by which time the study interviewers had established close relationships with the cohorts, facilitating the request for sensitive information. Subjects were asked to respond yes or no to each item. Subjects were also given an opportunity to discuss the questionnaire contents with interviewers in case of doubt as to whether specific experiences corresponded with the items. Adverse factors included verbal abuse from parents and physical and sexual abuse, conflict at home, strict education, mental cruelty, neglect, mental disorder in parents, excessive sharing of parental problems, illness, poverty, mistreatment at school, separation, and war or natural catastrophe. Protective factors included maternal and paternal affection, availability of an adult friend, impression of having had a happy childhood, parents perceived as doing their best, feeling happy at school, and having been raised by both parents.

Subjects were reexamined on 2 further occasions at 2-year intervals. At follow-up, the neurological and psychiatric examinations were repeated and medication use and incident illness were recorded. The Gospel Oak questionnaire was used to record life events occurring since the last examination. The present study was carried out on the 942 subjects for whom complete information was available on all variables used in the analyses (clinical examinations at all time points, childhood environment, genotype, depression measures, and all potential confounding variables). Ethics approval for the study was given by the national ethics committee. All subjects gave their signed consent for participation in the study.

DNA collection. Blood samples for DNA collection for 5-HTTLPR genotyping were taken after the baseline clinical interview. 5-HTTLPR insertion/deletion polymorphisms were assayed in 2 stages. Genomic DNA was extracted from white blood cells harvested from 15 mL ethylenediaminetetraacetic acid blood samples using DNA extraction kits from Amersham-Pharmacia Biotech (Buckinghamshire, United Kingdom). Subsequently, amplification of 5-HTTLPR was carried out using the primers HTTLPRF (GGCGTTGCCGCTCTGAATTGC) and HTTLPRR (GAGGGACTGAGCTGGACAACCCAC) in reaction mixtures with a total volume of 25 μL, with 200 ng of genomic DNA, 10 pM of the primers, 120 nM dNTP, containing 7-deaza-dGTP instead of dGTP (Roche, Rotkreuz, Switzerland), 5% dimethyl sulfoxide (Sigma, Buchs, Switzerland), 1.5 mM MgCl2, and 1.25 U Taq polymerase (Eurobio, Brunschwig; Basel, Switzerland). Temperatures were 60°C for 30 seconds for annealing and 72°C for 1 minute for extension. PCR products (8 μL) were subjected to 45 mn electrophoresis at 120V in a PCR CheckIT gel (Elchrom Scientific AG, Cham, Switzerland) before being viewed under ultraviolet light to assess the 5-HTTLPR genotypes. An adenosine/guanine (A/G) single nucleotide polymorphism (SNP; rs25531), located in the close vicinity of 5-HTTLPR, has recently been reported to modify transcriptional activity.23 On the basis of these in vitro functional data, it has been proposed to recode the 5-HTTLPR/rs25531 allele as S’ or "low-expressing allele" (SA, SG, and LG) and L’ or "high-expressing allele" (LA).24 As this new allelic dichotomy still awaits replication in in vivo studies, we initially examined both allelic systems (S/L and S’ /L’ ) within the present study. Recoding did not significantly alter results, so we report here only analyses relating to S and L.

Statistical Analysis

Univariate logistic regression was used to determine differences in unadjusted social and clinical characteristics between participants with and without depressive symptomatology. Variables found to be associated with current depression were used as adjustment variables in analyses relating to the association between childhood events and current depression. Polytomous logistic regression models were used to model the relationship between the number of depressive episodes (0, 1, 2 or more) and individual childhood events (binary) and to calculate the odds ratio and its 95% confidence interval (CI) for lifetime onset of a major depressive episode in relation to childhood events. The distribution of 5-HTTLPR was tested by χ2 for Hardy-Weinberg equilibrium.

We tested the hypothesis that 5-HTTLPR genotype might modify the relationship between depressive symptomatology and childhood events using a logistic regression model. We therefore stratified our analysis by 5-HTTLPR genotype and then added the interaction term to the full model and tested for its significance using Wald χ2 test given by the logistic regression model. Significance level was set at P < .05. The statistical analysis was carried out using SAS software, version 9.1 (SAS Institute Inc, Cary, NC).

RESULTS

The median (range) age of the sample was 72 (65-92) years. In this study, 38.4% of subjects scored over the cutoff point on the CES-D either at recruitment or at 1 of the 2 follow-up examinations, 23.5% had been diagnosed with major depression during their lifetime, and 12.6% were taking antidepressant medication at some point during the study. All subjects with diagnosed major depression scored over 16 on the CES-D, and 27 subjects (2.9%) taking antidepressant treatment did not meet either MINI or CES-D criteria for depression. These subjects were included as depressed on the assumption that a depressive episode had occurred but had been effectively treated and thus was not detected by the MINI or CES-D. The period prevalence (over the 4-year observation period) of significant depressive symptomatology in this cohort is estimated at 41.3%. The sociodemographic and clinical characteristics of subjects with significant levels of depressive symptomatology are given in Table 1.

Table 1

Click figure to enlarge

Depressed subjects compared to those without depression were more likely to be female (OR = 2.92, 95% CI = 2.21 to 3.86), to be older than 75 years (OR = 1.60, 95% CI = 1.11 to 2.31), to have medium-low education (OR = 2.07, 95% CI = 1.44 to 2.96), to be divorced/separated (OR = 1.87, 95% CI = 1.17 to 2.99) or widowed (OR = 2.15, 95% CI = 1.56 to 2.96), and to have lower rates of hypertension (OR = 0.59, 95% CI = 0.45 to 0.76). Experiencing adverse life events recently (in the year before and during follow-up) and before the onset of the depressive symptoms showed a significant P value trend. Subsequent analyses were thus adjusted for these competing causes of depression. No significant relationship was found between depression and dementia or other neurologic disorders, disability, recent cardiovascular or cerebrovascular disorder, or 5-HTTLPR allele.

Previous research on child maltreatment and depression has principally highlighted personally threatening events (items 1-6, including physical, sexual, and verbal abuse; Table 2) as being the most pathogenic.25 In this older population, we found that exposure to at least 1 of these events significantly increased risk of late-life depression (OR = 2.28, 95% CI = 1.53 to 3.41). Exposure to a major protective factor (maternal or paternal affection, availability of an adult friend; items 26-28, Table 2) conversely decreased overall risk (OR = 0.54, 95% CI = 0.28 to 1.01).

Table 2

Click figure to enlarge

We also examined the effects of childhood events on the number of depressive episodes occurring during the study period. Exposure to at least 1 adverse childhood event significantly increased the risk of having 1 episode of depression, with an OR = 1.72 (95% CI = 1.04 to 2.86), and for 2 or more episodes, with an OR = 2.89 (95% CI = 1.83 to 4.57) (P value for heterogeneity between these 2 ORs was .05). The presence of at least 1 protective factor gave a risk of OR = 1.03 (95% CI = 0.42 to 2.53) for 1 depressive episode and a protective effect of OR = 0.34 (95% CI = 0.17 to 0.69) for 2 or more episodes (P value for heterogeneity was .02) (data not shown).

The relationship between late-life depression and individual childhood life events was also examined using a logistic regression model. No significant sex interaction effects with individual childhood life events and depressive symptomatology were observed, so analyses were not gender stratified. Table 2 shows that a significant risk was associated with excessive sharing of parental problems with children (OR = 1.53, 95% CI = 1.04 to 2.27); poverty or financial difficulties (OR = 1.65, 95% CI = 1.17 to 2.31); mental disorder experienced by the father (OR = 2.13, 95% CI = 1.32 to 3.44) and mother (OR = 2.52, 95% CI = 1.65 to 3.85); excessive physical punishment for misbehavior (OR = 2.77, 95% CI = 1.41 to 5.46); verbal abuse from parents (OR = 2.90, 95% CI = 1.57 to 5.38); humiliation, harassment, or mental cruelty (OR = 4.31, 95% CI = 1.87 to 9.93); and other mistreatment by an adult outside the family (OR = 6.71, 95% CI = 1.80 to 25.0). A protective effect was observed for maternal affection (OR = 0.45, 95% CI = 0.29 to 0.70) and having the overall impression that parents had done their best (OR = 0.53, 95% CI = 0.30 to 0.92).

The distribution of 5-HTTLPR did not deviate from Hardy-Weinberg equilibrium (χ2 = 0.06, df = 2, P = .97). Interaction effects between 5-HTTLPR genotype and childhood events having a significant relationship with depressive symptomatology were examined, adjusting for age, gender, education, marital status, hypertension, and recent life events, with stratification by genotype.

The risk for depression in relation to too frequent sharing of parental problems with children was increased in LL subjects (OR = 1.93, 95% CI = 0.95 to 3.90) and in SL subjects (OR = 2.00, 95% CI = 1.15 to 3.48), with a nonsignificant tendency for protection in SS subjects (OR = 0.30, 95% CI = 0.08 to 1.19). A comparable pattern was observed in subjects who experienced poverty or financial difficulties. We observed a tendency for an increased risk for depression in LL subjects (OR = 1.51, 95% CI = 0.82 to 2.77), which was significant in SL subjects (OR = 2.54, 95% CI = 1.55 to 4.15). In the SS subjects, we found a nonsignificant tendency for reduced risk (OR = 0.64, 95% CI = 0.26 to 1.53).

Significant gene-event interactions were found in subjects with parents who excessively shared their problems (Wald χ2 = 7.23, df = 2, P = .027) and with poverty or financial difficulties (Wald χ2 = 7.38, df = 2, P = .025) (Figure 1).

Figure 1

Click figure to enlarge

As these results suggest a dominant effect of the L-carrying genotypes, we examined the effect of combining LL and LS subjects compared to SS subjects. The risk for depression with childhood poverty was significantly increased in LL/LS subjects (OR = 2.06, 95% CI = 1.42 to 3.00), with a nonsignificant tendency to be reduced in SS subjects (OR = 0.64, 95% CI = 0.26 to 1.53). The risk for depression in relation to too frequent sharing of parental problems with children was also increased in LL/LS subjects (OR = 1.94, 95% CI = 1.26 to 2.98), with a nonsignificant tendency to be reduced in SS subjects (OR = 0.30, 95% CI = 0.08 to 1.19).

Finally, subjects’ lifetime risk for major depressive episodes (MDEs) was also ascertained from the MINI, adjusting only for age, education, and gender (life events and hypertension at the time of the episode being unknown). Significant risk factors were found to be, in ascending order, maternal affection (OR = 0.51, 95% CI = 0.33 to 0.79), sharing of parental problems with children (OR = 1.68, 95% CI = 1.11 to 2.54), maternal mental illness (OR = 1.69, 95% CI = 1.11 to 2.59), verbal abuse from parents (OR = 1.94, 95% CI = 1.07 to 3.55), poverty or financial difficulties (OR = 1.97, 95% CI = 1.37 to 2.83), home conflict (OR = 2.09, 95% CI = 1.43 to 3.05), and physical and/or sexual abuse (OR = 2.72, 95% CI = 1.04 to 7.08). Alcohol abuse by father, neglect, and abuse by schoolmates were only significant risk factors for cases of early-onset depression (occurring before age 50 years; data not shown).

DISCUSSION

Our study of an elderly cohort suggests that adverse childhood events may continue to constitute a significant risk factor for depression throughout the life span. Exposure to traumatic events in childhood was observed to double the risk of late-life depression and increase the risk of repeated episodes. On the other hand, protective factors were seen to diminish the risk of late-life depression and repeated episodes. A relationship between trauma and risk of chronicity has also been observed by Bernet and Stein,5 who found increasing number of lifetime episodes to be also associated with severity of trauma, but numbers in our study were too small to break down number of depressive episodes by individual items.

Recent studies of the impact of life events on psychological functioning have underlined the necessity of examining the impact of individual stressors rather than summating events in aggregate measures due to the differential effect of specific events.26 Our findings support this observation. Of the 25 negative factors studied, late-life depression was found to be significantly associated with only 8: verbal abuse from parents, mental cruelty, excessive punishment by parents, abuse by an adult outside the family, parental mental disorder, poverty, home conflict, and excessive sharing of parental problems with children. Physical and sexual abuse did not quite reach significance; however, only a small number of cases (n = 13) were reported. Maternal affection, impression of having had a happy childhood, and feeling that parents did their best constituted protective factors. These early life events were found to be pathogenic or protective even when potential proximal causes of depression (blood pressure, widowhood and separation, recent life events) were taken into account. No interactive effect was found with sex, although previous studies have reported gender differences in vulnerability to adverse life events occurring later in life.27 Examining individual childhood events and lifetime risk for MDE, we found certain events to be related only to MDE occurring before age 50 years (neglect, paternal alcohol problems, and mistreatment at school by classmates) and others to be related to MDE onset both before and after age 50 years (verbal and physical abuse, maternal mental disorder, and poverty), suggesting some events to have less far-reaching effects than others.

No association was found between 5-HTTLPR and late-life depression. This observation is in accordance with previous meta-analyses suggesting that these polymorphisms do not directly modulate vulnerability to depression.9 Significant interaction was observed, however, between these polymorphisms and some childhood environmental factors. Interestingly, these gene-environment interactions appear to concern more general and long lasting environmental conditions, such as poverty, rather than specific aggressive acts of limited duration. This latter type of event may interact, on the other hand, with genes coding for proteins involved in the development and plasticity of the central nervous system, such as brain-derived neurotrophic factor.28 Most previous human genotype-by-environment studies report a susceptibility (codominant, dominant, or recessive) effect with the S-carrying genotypes.9 On the contrary, in the present population, we found a susceptibility-dominant effect with the LL/LS genotypes. Surtees et al12 reported a similar interaction for past-year prevalent depression and adverse experience in childhood in men—(LL homozygotes) OR = 1.69, 95% CI = 1.17 to 2.44; (LS heterozygotes) OR = 1.26, 95% CI = 0.91 to 1.75. This interaction did not quite reach significance, and the authors suggest this may be due to the fact that it may have occurred predominantly in older subjects, the wide age range of the sample (41-80 years) masking the true effect. Our results lend further support to the hypothesis of a different form of interaction in late-life as opposed to early-onset depression. The L allele has very recently been linked to increased cardiovascular reactivity to mental stress,29 which may in turn lead to subcortical ischemic disease and volumetric changes, notably in the hippocampus. The authors noted, furthermore, that increased cardiovascular reactivity in adulthood was also observed to be associated with childhood poverty.

We conclude from this study that certain types of early childhood trauma continue to constitute risk factors for depression in old age, their effect outweighing more recent life events and other proximal causes of depression. 5-HTTLPR genotype alone does not modulate the effect of highly pathogenic events involving individual victimization, but it may increase vulnerability to global environmental factors such as poverty and excessive sharing of parental problems. Strengths of this study were the large, representative general population cohort, which allowed us to take into account competing causes of depression; analysis of a wide range of individual childhood events; and clinical assessment of late-life depressive episodes. There were 2 principal shortcomings in this study: (1) We assumed that subjects taking antidepressant treatment were depressed, which may not have been the case since antidepressants may be prescribed for other neurologic conditions. This may have weakened the associations examined; however, we could not eliminate these subjects as they would at least in part constitute a successfully treated depressed group. (2) The use of a self-report measure of childhood events may also have weakened the associations examined in this study; prospective data from birth cohorts would have been preferable in terms of reducing recall bias. Further studies of this cohort examining possible biologic correlates of the impact of adverse childhood events, such as persistence of abnormal basal cortisol levels and elevated adrenocorticotropic hormone response, as observed in cohorts of abused children,30 may provide further validation of self-reported adversity and support for the hypothesis that childhood abuse leads to permanent structural and functional changes of the nervous system.

Author affiliations: Inserm, U888, Montpellier and Université Montpellier 1 (all authors); Laboratoire de Biochimie, Hôpital Lapeyronie (Dr Dupuy) and Service de Psychologie Médicale et Psychiatrie (Dr Courtet), Centre Hospitalier Universitaire, Montpellier, France; Institute of Psychiatry, King’s College London, United Kingdom (Dr Stewart); and University Hospital and School of Medicine of Geneva, University of Geneva, Switzerland (Dr Malafosse).

Author contributions: Dr Ritchie and Ms Jaussent are joint first authors.

Financial disclosure: Drs Ritchie, Stewart, Dupuy, Courtet, Ancelin, and Malafosse and Ms Jaussent report no additional financial or other relationship relevant to the subject of this article.

Funding/support: The Esprit project, from which the present study’s population was drawn, is financed by the regional government of Languedoc-Roussillon, France; the Agence National de Recherche Project 07 LVIE 004; Swiss National Foundation (grant #32-112084); and an unconditional grant from Novartis.

REFERENCES

1. Shea A, Walsh C, Macmillan H, et al. Child maltreatment and HPA axis dysregulation: relationship to major depressive disorder and post traumatic stress disorder in females. Psychoneuroendocrinology. 2005;30(2):162-178. PubMed doi:10.1016/j.psyneuen.2004.07.001

2. Teicher MH, Andersen SL, Polcari A, et al. Developmental neurobiology of childhood stress and trauma. Psychiatr Clin North Am. 2002;25(2):397-426 [vii-viii.]. PubMed doi:10.1016/S0193-953X(01)00003-X

3. Teicher MH, Andersen SL, Polcari A, et al. The neurobiological consequences of early stress and childhood maltreatment. Neurosci Biobehav Rev. 2003;27(1-2):33-44. PubMed doi:10.1016/S0149-7634(03)00007-1

4. Heim C, Nemeroff CB. The role of childhood trauma in the neurobiology of mood and anxiety disorders: preclinical and clinical studies. Biol Psychiatry. 2001;49(12):1023-1039. PubMed doi:10.1016/S0006-3223(01)01157-X

5. Bernet CZ, Stein MB. Relationship of childhood maltreatment to the onset and course of major depression in adulthood. Depress Anxiety. 1999;9(4):169-174. PubMed doi:10.1002/(SICI)1520-6394(1999)9:4<169::AID-DA4>3.0.CO;2-2

6. Kaufman J, Charney D. Effects of early stress on brain structure and function: implications for understanding the relationship between child maltreatment and depression. Dev Psychopathol. 2001;13(3):451-471. PubMed doi:10.1017/S0954579401003030

7. Caspi A, Sugden K, Moffitt TE, et al. Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science. 2003;301(5631):386-389. PubMed doi:10.1126/science.1083968

8. Kaufman J, Yang BZ, Douglas-Palumberi H, et al. Social supports and serotonin transporter gene moderate depression in maltreated children. Proc Natl Acad Sci U S A. 2004;101(49):17316-17321. PubMed doi:10.1073/pnas.0404376101

9. Uher R, McGuffin P. The moderation by the serotonin transporter gene of environmental adversity in the aetiology of mental illness: review and methodological analysis. Mol Psychiatry. 2008;13(2):131-146. PubMed doi:10.1038/sj.mp.4002067

10. Taylor SE, Way BM, Welch WT, et al. Early family environment, current adversity, the serotonin transporter promoter polymorphism, and depressive symptomatology. Biol Psychiatry. 2006;60(7):671-676. PubMed doi:10.1016/j.biopsych.2006.04.019

11. Kraaij V, de Wilde EJ. Negative life events and depressive symptoms in the elderly: a life span perspective. Aging Ment Health. 2001;5(1):84-91. PubMed doi:10.1080/13607860020020681

12. Surtees PG, Wainwright NW, Willis-Owen SA, et al. Social adversity, the serotonin transporter (5-HTTLPR) polymorphism and major depressive disorder. Biol Psychiatry. 2006;59(3):224-229. PubMed doi:10.1016/j.biopsych.2005.07.014

13. Taylor WD, Steffens DC, Payne ME, et al. Influence of serotonin transporter promoter region polymorphisms on hippocampal volumes in late-life depression. Arch Gen Psychiatry. 2005;62(5):537-544. PubMed doi:10.1001/archpsyc.62.5.537

14. Moffitt TE, Caspi A, Rutter M. Strategy for investigating interactions between measured genes and measured environments. Arch Gen Psychiatry. 2005;62(5):473-481. PubMed doi:10.1001/archpsyc.62.5.473

15. Ritchie K, Artero S, Beluche I, et al. Prevalence of DSM-IV psychiatric disorder in the French elderly population. Br J Psychiatry. 2004;184:147-152. PubMed doi:10.1192/bjp.184.2.147

16. World Health Organization. World Health Organization Collaborating Centre for Drug Statistics Methodology. Guidelines for ATC Classification and DDD Assignment. Oslo, Norway: World Health Organization; 2000.

17. Lawton MP, Brody EM. Assessment of older people: self-maintaining and instrumental activities of daily living. Gerontologist. 1969;9(3):179-186. PubMed

18. Harwood RH, Prince MJ, Mann AH, et al. The prevalence of diagnoses, impairments, disabilities and handicaps in a population of elderly people living in a defined geographical area: the Gospel Oak project. Age Ageing. 1998;27(6):707-714. PubMed doi:10.1093/ageing/27.6.707

19. World Health Organization. International Classification of Diseases, Tenth Revision. World Health Organization; 1992.

20. Lecrubier Y, Sheehan D, Weiller E, et al. The Mini International Neuropsychiatric Interview (MINI). A short diagnostic structured interview: reliability and validity according to the CIDI. Eur Psychiatry. 1997;12:224-231. doi:10.1016/S0924-9338(97)83296-8

21. American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders. 4th ed. Washington, DC: American Psychiatric Association; 1994.

22. Radloff LS. The CES-D scale: a self-report depression scale for research in the general population. Appl Psychol Meas. 1977;1:385-401. doi:10.1177/014662167700100306

23. Hu XZ, Lipsky RH, Zhu G, et al. Serotonin transporter promoter gain-of-function genotypes are linked to obsessive-compulsive disorder. Am J Hum Genet. 2006;78(5):815-826. PubMed doi:10.1086/503850

24. Parsey RV, Hastings RS, Oquendo MA, et al. Effect of a triallelic functional polymorphism of the serotonin-transporter-linked promoter region on expression of serotonin transporter in the human brain. Am J Psychiatry. 2006;163(1):48-51. PubMed doi:10.1176/appi.ajp.163.1.48

25. Teicher MH, Samson JA, Polcari A, et al. Sticks, stones, and hurtful words: relative effects of various forms of childhood maltreatment. Am J Psychiatry. 2006;163(6):993-1000. PubMed doi:10.1176/appi.ajp.163.6.993

26. Rosnick CB, Small BJ, McEvoy CL, et al. Negative life events and cognitive performance in a population of older adults. J Aging Health. 2007;19(4):612-629. PubMed doi:10.1177/0898264307300975

27. Murphy JM, Laird NM, Monson RR, et al. A 40-year perspective on the prevalence of depression: the Stirling County Study. Arch Gen Psychiatry. 2000;57(3):209-215. PubMed doi:10.1001/archpsyc.57.3.209

28. Perroud N, Courtet P, Vincze I, et al. Interaction between BDNF Val66Met and childhood trauma on adult’s violent suicide attempt. Genes Brain Behav. 2008;7(3):314-322. PubMed doi:10.1111/j.1601-183X.2007.00354.x

29. Williams RB, Marchuk DA, Siegler IC, et al. Childhood socioeconomic status and serotonin transporter gene polymorphism enhance cardiovascular reactivity to mental stress. Psychosom Med. 2008;70(1):32-39. PubMed doi:10.1097/PSY.0b013e31815f66c3

30. Tarullo AR, Gunnar MR. Child maltreatment and the developing HPA axis. Horm Behav. 2006;50(4):632-639. PubMed doi:10.1016/j.yhbeh.2006.06.010

Download Premium PDF

Enjoy this premium PDF as part of your membership benefits!